Transcript: Mouse XM_017318391.1

PREDICTED: Mus musculus 5-hydroxytryptamine (serotonin) receptor 2C (Htr2c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Htr2c (15560)
Length:
3593
CDS:
30..911

Additional Resources:

NCBI RefSeq record:
XM_017318391.1
NBCI Gene record:
Htr2c (15560)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027485 CGGCATACCAATGAACGTGTA pLKO.1 783 CDS 100% 4.050 5.670 N Htr2c n/a
2 TRCN0000027426 CCCGTTGACAATTATGGTGAT pLKO.1 209 CDS 100% 4.050 3.240 N Htr2c n/a
3 TRCN0000027492 CGAGAGGATTAGTAGTGTGTA pLKO.1 890 CDS 100% 4.950 3.465 N Htr2c n/a
4 TRCN0000027431 GCTTCCAAAGTCCTTGGCATT pLKO.1 459 CDS 100% 4.050 2.835 N Htr2c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.