Transcript: Mouse XM_017318481.1

PREDICTED: Mus musculus protein phosphatase with EF hand calcium-binding domain 1 (Ppef1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppef1 (237178)
Length:
3331
CDS:
279..2246

Additional Resources:

NCBI RefSeq record:
XM_017318481.1
NBCI Gene record:
Ppef1 (237178)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081218 CCCGCCAAAGAGATAACAATA pLKO.1 789 CDS 100% 13.200 18.480 N LOC436244 n/a
2 TRCN0000081219 TCCCGCCAAAGAGATAACAAT pLKO.1 788 CDS 100% 5.625 7.875 N LOC436244 n/a
3 TRCN0000080862 GCTTTCAAGATACTAAAGGAA pLKO.1 1713 CDS 100% 3.000 2.400 N Ppef1 n/a
4 TRCN0000080860 GCCGAATTTCTCTCATGTAAA pLKO.1 761 CDS 100% 13.200 9.240 N Ppef1 n/a
5 TRCN0000080858 GCTCATTACAAAGCTCATATA pLKO.1 2094 CDS 100% 13.200 9.240 N Ppef1 n/a
6 TRCN0000081220 GAAGTGCCTGACTCCTATGAT pLKO.1 606 CDS 100% 5.625 3.938 N LOC436244 n/a
7 TRCN0000081222 GTCTTAGAGGTGCTATTTGAA pLKO.1 717 CDS 100% 5.625 3.938 N LOC436244 n/a
8 TRCN0000080861 AGAGAAATAAATCAGCGTCAA pLKO.1 1267 CDS 100% 4.050 2.835 N Ppef1 n/a
9 TRCN0000080859 CGTCAAATTATGTTGAACCAA pLKO.1 1282 CDS 100% 3.000 2.100 N Ppef1 n/a
10 TRCN0000002549 GTGACTTTGTAGATCGAGGAA pLKO.1 901 CDS 100% 2.640 1.584 N PPEF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.