Transcript: Mouse XM_017318593.1

PREDICTED: Mus musculus inter-alpha (globulin) inhibitor H5-like, pseudogene (Itih5l-ps), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Itih5l-ps (634882)
Length:
3330
CDS:
23..3214

Additional Resources:

NCBI RefSeq record:
XM_017318593.1
NBCI Gene record:
Itih5l-ps (634882)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318593.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092646 CGTGGTGTCTCGTTATGCAAA pLKO.1 190 CDS 100% 4.950 6.930 N Itih5l-ps n/a
2 TRCN0000092644 CCTCAACCTATCCCTTGAATA pLKO.1 1831 CDS 100% 13.200 9.240 N Itih5l-ps n/a
3 TRCN0000092645 CCTCAATGTGACCCACTTTAT pLKO.1 1714 CDS 100% 13.200 9.240 N Itih5l-ps n/a
4 TRCN0000092647 AGCAGGCACAAAGGCAACTTT pLKO.1 466 CDS 100% 5.625 3.938 N Itih5l-ps n/a
5 TRCN0000092643 CGGCTCTATGTTTGGAACTAA pLKO.1 928 CDS 100% 5.625 3.938 N Itih5l-ps n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318593.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.