Transcript: Mouse XM_017318605.1

PREDICTED: Mus musculus TGF-beta activated kinase 1/MAP3K7 binding protein 3 (Tab3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tab3 (66724)
Length:
1915
CDS:
22..1788

Additional Resources:

NCBI RefSeq record:
XM_017318605.1
NBCI Gene record:
Tab3 (66724)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258104 GCTGCTACTCCCAACTATAAT pLKO_005 415 CDS 100% 15.000 21.000 N Tab3 n/a
2 TRCN0000250823 AGTCCGTCACCTATCAGTAAT pLKO_005 1180 CDS 100% 13.200 18.480 N Tab3 n/a
3 TRCN0000378448 ACATGCACATACCTCGGTATA pLKO_005 572 CDS 100% 10.800 15.120 N Tab3 n/a
4 TRCN0000362855 CATTACAGCCAGCGTCCTTTA pLKO_005 799 CDS 100% 10.800 15.120 N Tab3 n/a
5 TRCN0000250822 ATGGATCTCCTGGGTCTATTT pLKO_005 692 CDS 100% 13.200 9.240 N Tab3 n/a
6 TRCN0000216710 CAACAAGGACCTCCTAGTTAT pLKO.1 1033 CDS 100% 13.200 9.240 N Tab3 n/a
7 TRCN0000258106 CAACAAGGACCTCCTAGTTAT pLKO_005 1033 CDS 100% 13.200 9.240 N Tab3 n/a
8 TRCN0000362848 TGGTCGGACACTGGTACATAG pLKO_005 303 CDS 100% 10.800 7.560 N Tab3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.