Transcript: Mouse XM_017318614.2

PREDICTED: Mus musculus deoxyribonuclease 1-like 1 (Dnase1l1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Dnase1l1 (69537)
Length:
913
CDS:
365..841

Additional Resources:

NCBI RefSeq record:
XM_017318614.2
NBCI Gene record:
Dnase1l1 (69537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311232 TCCGCATCAGTGACCATTATC pLKO_005 829 CDS 100% 13.200 9.240 N Dnase1l1 n/a
2 TRCN0000108732 CAGGAGTTACAGCTTCCTAAA pLKO.1 649 CDS 100% 10.800 7.560 N Dnase1l1 n/a
3 TRCN0000303079 CAGGAGTTACAGCTTCCTAAA pLKO_005 649 CDS 100% 10.800 7.560 N Dnase1l1 n/a
4 TRCN0000108733 CATTTCACTCTCCCTAGCAAA pLKO.1 803 CDS 100% 4.950 3.465 N Dnase1l1 n/a
5 TRCN0000108734 GAGTCAGTGATGGATACCTTA pLKO.1 530 CDS 100% 4.950 3.465 N Dnase1l1 n/a
6 TRCN0000303080 GAGTCAGTGATGGATACCTTA pLKO_005 530 CDS 100% 4.950 3.465 N Dnase1l1 n/a
7 TRCN0000305032 GACAAGACACAGGTCCTAAAT pLKO_005 728 CDS 100% 13.200 7.920 N Dnase1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318614.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.