Transcript: Mouse XM_017318639.1

PREDICTED: Mus musculus MAP7 domain containing 2 (Map7d2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map7d2 (78283)
Length:
3412
CDS:
24..2213

Additional Resources:

NCBI RefSeq record:
XM_017318639.1
NBCI Gene record:
Map7d2 (78283)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318639.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090998 CCTGCATTTGACTAACTGTAA pLKO.1 3018 3UTR 100% 4.950 6.930 N Map7d2 n/a
2 TRCN0000091000 CCGAGAAGTATGTAGCAGATA pLKO.1 1159 CDS 100% 4.950 3.960 N Map7d2 n/a
3 TRCN0000090999 GCGCATAGAAATGGCCTATAA pLKO.1 1406 CDS 100% 13.200 9.240 N Map7d2 n/a
4 TRCN0000091002 CCCTCTCAAATCTTCATACAA pLKO.1 689 CDS 100% 5.625 3.938 N Map7d2 n/a
5 TRCN0000091001 GCTGCTAAACAGATGCGTTTA pLKO.1 1614 CDS 100% 1.080 0.756 N Map7d2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318639.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.