Transcript: Mouse XM_017319036.1

PREDICTED: Mus musculus predicted gene, 20783 (Gm20783), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm20783 (671650)
Length:
5443
CDS:
16..2277

Additional Resources:

NCBI RefSeq record:
XM_017319036.1
NBCI Gene record:
Gm20783 (671650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319036.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240295 GGCAGAACCCAGAGGATTATT pLKO_005 984 CDS 100% 15.000 10.500 N Gm20783 n/a
2 TRCN0000240297 GTAGCAACAAAGGATACATAT pLKO_005 277 CDS 100% 13.200 9.240 N Gm20783 n/a
3 TRCN0000240296 ACAATGGGATGTCATCATAAA pLKO_005 618 CDS 100% 13.200 7.920 N Gm20783 n/a
4 TRCN0000257361 CAGACCACATTTGGAGTATTT pLKO_005 1681 CDS 100% 13.200 6.600 Y Gm20783 n/a
5 TRCN0000257316 TTGTACCTTAATCCAACTTAT pLKO_005 1830 CDS 100% 13.200 6.600 Y Gm20783 n/a
6 TRCN0000104882 CTTTGGACCATTTAATCCTAA pLKO.1 219 CDS 100% 4.950 2.475 Y Vmn2r-ps159 n/a
7 TRCN0000188910 GCTTTCAAGCTCACTACTCCA pLKO.1 1753 CDS 100% 2.640 1.320 Y LOC436147 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319036.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.