Transcript: Mouse XM_017319059.1

PREDICTED: Mus musculus zinc finger protein 335 (Zfp335), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp335 (329559)
Length:
4797
CDS:
432..4550

Additional Resources:

NCBI RefSeq record:
XM_017319059.1
NBCI Gene record:
Zfp335 (329559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242190 ATACCGAAAGTACTACTATAA pLKO_005 1781 CDS 100% 13.200 18.480 N Zfp335 n/a
2 TRCN0000242189 GCATCGAGTACGACGTCATTA pLKO_005 4488 CDS 100% 13.200 18.480 N Zfp335 n/a
3 TRCN0000242188 ACGCTGACTGATCGTGGATAT pLKO_005 4540 CDS 100% 10.800 15.120 N Zfp335 n/a
4 TRCN0000242192 GGTCCCTGATGGCCATCATAT pLKO_005 4145 CDS 100% 13.200 10.560 N Zfp335 n/a
5 TRCN0000420350 AGATCACACACATCCAGTATG pLKO_005 4263 CDS 100% 10.800 7.560 N ZNF335 n/a
6 TRCN0000242191 GGCCTTATCTGTGCCGCATAT pLKO_005 1822 CDS 100% 10.800 7.560 N Zfp335 n/a
7 TRCN0000173959 GAGACCTCAGACCTTCATGAT pLKO.1 1527 CDS 100% 4.950 3.465 N Zfp335 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.