Transcript: Mouse XM_017319128.1

PREDICTED: Mus musculus serine/threonine kinase 39 (Stk39), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stk39 (53416)
Length:
2926
CDS:
16..1452

Additional Resources:

NCBI RefSeq record:
XM_017319128.1
NBCI Gene record:
Stk39 (53416)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426228 CAAGAACGCGTAGCCATAAAG pLKO_005 73 CDS 100% 13.200 18.480 N Stk39 n/a
2 TRCN0000416001 CACTCCCAAATCCCAACAAAT pLKO_005 1535 3UTR 100% 13.200 10.560 N Stk39 n/a
3 TRCN0000025152 GCCCAACCAAACGCTAATGAA pLKO.1 1123 CDS 100% 5.625 4.500 N Stk39 n/a
4 TRCN0000413867 CACTCCGAGTTCTGCTTTATT pLKO_005 1639 3UTR 100% 15.000 10.500 N Stk39 n/a
5 TRCN0000420307 TCATCAAATACATCGTTAATC pLKO_005 263 CDS 100% 13.200 9.240 N Stk39 n/a
6 TRCN0000025150 CCCTCCAATGAAAGTGCTAAT pLKO.1 645 CDS 100% 10.800 7.560 N Stk39 n/a
7 TRCN0000025153 GTAGTTATAGTGGCTGCTAAT pLKO.1 1303 CDS 100% 10.800 7.560 N Stk39 n/a
8 TRCN0000195205 CTTAATGACATACGATTTGAG pLKO.1 1207 CDS 100% 4.950 3.465 N STK39 n/a
9 TRCN0000025149 GCCGTTCTGTTAGATTGCTAA pLKO.1 2363 3UTR 100% 4.950 3.465 N Stk39 n/a
10 TRCN0000025151 GCTCAGTACAAATAGCAGATT pLKO.1 428 CDS 100% 4.950 3.465 N Stk39 n/a
11 TRCN0000001005 CCTGATGAAGTGAAGCTGATT pLKO.1 1405 CDS 100% 4.950 2.970 N STK39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.