Transcript: Mouse XM_017319242.1

PREDICTED: Mus musculus transformation related protein 53 inducible nuclear protein 2 (Trp53inp2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trp53inp2 (68728)
Length:
5076
CDS:
1341..2021

Additional Resources:

NCBI RefSeq record:
XM_017319242.1
NBCI Gene record:
Trp53inp2 (68728)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319242.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247957 GCACCAGGGCAGCTTTATTTA pLKO_005 1970 CDS 100% 15.000 12.000 N Trp53inp2 n/a
2 TRCN0000247955 GCCTCGCTCCTGACCTAATTT pLKO_005 4054 3UTR 100% 15.000 12.000 N Trp53inp2 n/a
3 TRCN0000247953 GCCACACATTGAGTGCTAAAG pLKO_005 1900 CDS 100% 10.800 8.640 N Trp53inp2 n/a
4 TRCN0000247956 GCATCCCAGCATGTCCGTTTA pLKO_005 1661 CDS 100% 10.800 7.560 N Trp53inp2 n/a
5 TRCN0000175328 CACATTGAGTGCTAAAGTGTT pLKO.1 1904 CDS 100% 4.950 3.465 N Trp53inp2 n/a
6 TRCN0000435645 CAGCGCCAGTTCAACTACTGA pLKO_005 2001 CDS 100% 3.000 2.100 N TP53INP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319242.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.