Transcript: Mouse XM_017319245.1

PREDICTED: Mus musculus adenylate kinase 8 (Ak8), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ak8 (68870)
Length:
1599
CDS:
390..1535

Additional Resources:

NCBI RefSeq record:
XM_017319245.1
NBCI Gene record:
Ak8 (68870)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319245.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024650 GCCAAGAGTTACTACCAGGTT pLKO.1 783 CDS 100% 2.640 3.696 N Ak8 n/a
2 TRCN0000360718 GTGCCGAAGGTTGTGATATTA pLKO_005 645 CDS 100% 15.000 12.000 N Ak8 n/a
3 TRCN0000360644 CTACCCTTCTGGCCCAGAAAT pLKO_005 1330 CDS 100% 13.200 9.240 N Ak8 n/a
4 TRCN0000360719 GTGGCTCTGCAAACATCTAAA pLKO_005 701 CDS 100% 13.200 9.240 N Ak8 n/a
5 TRCN0000024649 GCCCAGAAATATGGCCTTGTA pLKO.1 1341 CDS 100% 4.950 3.465 N Ak8 n/a
6 TRCN0000024653 GTTTACAAGAAGATTCCCAAT pLKO.1 801 CDS 100% 4.050 2.835 N Ak8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319245.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.