Transcript: Mouse XM_017319263.1

PREDICTED: Mus musculus Rho GTPase activating protein 21 (Arhgap21), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap21 (71435)
Length:
15305
CDS:
11405..15223

Additional Resources:

NCBI RefSeq record:
XM_017319263.1
NBCI Gene record:
Arhgap21 (71435)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252186 ACGCAGAGAGGTCCATATAAA pLKO_005 13750 CDS 100% 15.000 21.000 N Arhgap21 n/a
2 TRCN0000252184 AGCGGCAATGCCCGTAATATA pLKO_005 11993 CDS 100% 15.000 21.000 N Arhgap21 n/a
3 TRCN0000258194 TTACGACACTTCATCGTTTAT pLKO_005 11615 CDS 100% 13.200 18.480 N Arhgap21 n/a
4 TRCN0000154948 GCACATAGGTTGTCGGACAAT pLKO.1 12625 CDS 100% 4.950 6.930 N ARHGAP21 n/a
5 TRCN0000201143 CCAAAGGTCCTGAGTTCAAAT pLKO.1 2832 5UTR 100% 13.200 6.600 Y Ptcra n/a
6 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 2840 5UTR 100% 2.640 1.320 Y Adsl n/a
7 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 2840 5UTR 100% 2.640 1.320 Y Adsl n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 184 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.