Transcript: Mouse XM_017319342.1

PREDICTED: Mus musculus ADAMTS-like 2 (Adamtsl2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adamtsl2 (77794)
Length:
2242
CDS:
236..2155

Additional Resources:

NCBI RefSeq record:
XM_017319342.1
NBCI Gene record:
Adamtsl2 (77794)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319342.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092582 GCCATGTGTGTTCGCTATGAT pLKO.1 2018 CDS 100% 5.625 7.875 N Adamtsl2 n/a
2 TRCN0000092579 GCTGGTTTCTACTTCTTCAAT pLKO.1 1013 CDS 100% 5.625 3.938 N Adamtsl2 n/a
3 TRCN0000092580 TGGATTTGACAGCTCCGTGTA pLKO.1 2222 3UTR 100% 4.050 2.835 N Adamtsl2 n/a
4 TRCN0000118524 CCTGAATGTCATGGTGTGGAA pLKO.1 1162 CDS 100% 2.640 1.848 N ADAMTSL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319342.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.