Transcript: Mouse XM_017319347.2

PREDICTED: Mus musculus cytochrome c oxidase subunit 4I2 (Cox4i2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cox4i2 (84682)
Length:
771
CDS:
95..613

Additional Resources:

NCBI RefSeq record:
XM_017319347.2
NBCI Gene record:
Cox4i2 (84682)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076547 CCATCGCTCCAACGAATGGAA pLKO.1 385 CDS 100% 3.000 4.200 N Cox4i2 n/a
2 TRCN0000076546 CGCTCCTATCCCATGCCGGAT pLKO.1 227 CDS 100% 0.000 0.000 N Cox4i2 n/a
3 TRCN0000076544 GCGAGTCTATGTGTTCCCTAA pLKO.1 466 CDS 100% 4.050 3.240 N Cox4i2 n/a
4 TRCN0000076545 AGTCTATGTGTTCCCTAAGAA pLKO.1 469 CDS 100% 5.625 3.938 N Cox4i2 n/a
5 TRCN0000076543 CCATGAAACCTTCGCAGAGAT pLKO.1 361 CDS 100% 4.950 3.465 N Cox4i2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.