Transcript: Mouse XM_017319474.1

PREDICTED: Mus musculus microsomal triglyceride transfer protein (Mttp), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mttp (17777)
Length:
3603
CDS:
626..3310

Additional Resources:

NCBI RefSeq record:
XM_017319474.1
NBCI Gene record:
Mttp (17777)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105017 GCCCTCCTTAGTAAGTTCAAA pLKO.1 1853 CDS 100% 5.625 3.938 N Mttp n/a
2 TRCN0000325933 GCCCTCCTTAGTAAGTTCAAA pLKO_005 1853 CDS 100% 5.625 3.938 N Mttp n/a
3 TRCN0000105019 CCAACAAACCATAGCAGGAAA pLKO.1 1351 CDS 100% 4.950 3.465 N Mttp n/a
4 TRCN0000325935 CCAACAAACCATAGCAGGAAA pLKO_005 1351 CDS 100% 4.950 3.465 N Mttp n/a
5 TRCN0000105016 CCCATCCTACATGGATGTGAA pLKO.1 2275 CDS 100% 0.495 0.347 N Mttp n/a
6 TRCN0000105018 CCTGAACATCTTCCAGTACAT pLKO.1 2563 CDS 100% 4.950 2.970 N Mttp n/a
7 TRCN0000325934 CCTGAACATCTTCCAGTACAT pLKO_005 2563 CDS 100% 4.950 2.970 N Mttp n/a
8 TRCN0000105015 TCCACCAGAACGATATGCTAT pLKO.1 3327 3UTR 100% 4.950 3.465 N Mttp n/a
9 TRCN0000326001 TCCACCAGAACGATATGCTAT pLKO_005 3327 3UTR 100% 4.950 3.465 N Mttp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.