Transcript: Mouse XM_017319494.1

PREDICTED: Mus musculus neuroligin 1 (Nlgn1), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nlgn1 (192167)
Length:
5798
CDS:
1470..4001

Additional Resources:

NCBI RefSeq record:
XM_017319494.1
NBCI Gene record:
Nlgn1 (192167)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032021 GCAGACCTTCACTCGAACTTT pLKO.1 2946 CDS 100% 5.625 4.500 N Nlgn1 n/a
2 TRCN0000032019 CCCAACACTATACCAGGGATT pLKO.1 3882 CDS 100% 4.050 3.240 N Nlgn1 n/a
3 TRCN0000222040 CCTGCTGACTTTATCCCATTA pLKO.1 2333 CDS 100% 10.800 7.560 N NLGN1 n/a
4 TRCN0000032022 CCTGTACTACAAGAAGGATAA pLKO.1 3617 CDS 100% 10.800 7.560 N Nlgn1 n/a
5 TRCN0000032020 CCCTTGCGAATCACTGTGTTT pLKO.1 2283 CDS 100% 4.950 3.465 N Nlgn1 n/a
6 TRCN0000032023 CCTTACAAAGAACTTGTTGAT pLKO.1 2541 CDS 100% 4.950 3.465 N Nlgn1 n/a
7 TRCN0000222042 CCCAAACCAGTGATGGTGTAT pLKO.1 2043 CDS 100% 4.950 2.970 N NLGN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.