Transcript: Mouse XM_017319565.1

PREDICTED: Mus musculus centromere protein E (Cenpe), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cenpe (229841)
Length:
7834
CDS:
123..7535

Additional Resources:

NCBI RefSeq record:
XM_017319565.1
NBCI Gene record:
Cenpe (229841)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294792 TGAGGAACTATCCGATAATTT pLKO_005 3083 CDS 100% 15.000 21.000 N Cenpe n/a
2 TRCN0000294860 ACTTAGTTTCAGTCTAATTTC pLKO_005 7646 3UTR 100% 13.200 9.240 N Cenpe n/a
3 TRCN0000089923 CCGAGTTTGAAATGTTGAATA pLKO.1 1528 CDS 100% 13.200 9.240 N Cenpe n/a
4 TRCN0000287430 CCGAGTTTGAAATGTTGAATA pLKO_005 1528 CDS 100% 13.200 9.240 N Cenpe n/a
5 TRCN0000089927 GCAGCATGAGTCCATCAATAA pLKO.1 6176 CDS 100% 13.200 9.240 N Cenpe n/a
6 TRCN0000298325 GCAGCATGAGTCCATCAATAA pLKO_005 6176 CDS 100% 13.200 9.240 N Cenpe n/a
7 TRCN0000089926 CGACTCTCTAATGCAGGAGAA pLKO.1 3239 CDS 100% 4.050 2.835 N Cenpe n/a
8 TRCN0000287367 CGACTCTCTAATGCAGGAGAA pLKO_005 3239 CDS 100% 4.050 2.835 N Cenpe n/a
9 TRCN0000183415 CAGCAGCAACTTCTTAGTATT pLKO.1 3522 CDS 100% 13.200 9.240 N KLHL36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.