Transcript: Mouse XM_017319607.1

PREDICTED: Mus musculus centrosome and spindle pole associated protein 1 (Cspp1), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cspp1 (211660)
Length:
6102
CDS:
3122..5476

Additional Resources:

NCBI RefSeq record:
XM_017319607.1
NBCI Gene record:
Cspp1 (211660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253071 CTTACGATGATGCGTACTATT pLKO_005 3351 CDS 100% 13.200 18.480 N Cspp1 n/a
2 TRCN0000253073 TCGATATCACAAGTCCATTTG pLKO_005 1152 5UTR 100% 10.800 15.120 N Cspp1 n/a
3 TRCN0000122820 GCAAACTCCAAAGACCTCCTT pLKO.1 4386 CDS 100% 2.640 3.696 N CSPP1 n/a
4 TRCN0000253074 GAGGAACCCAATGGATATATT pLKO_005 4633 CDS 100% 15.000 10.500 N Cspp1 n/a
5 TRCN0000253070 CTTGCTTGTGGCCCTACTTTA pLKO_005 5545 3UTR 100% 13.200 9.240 N Cspp1 n/a
6 TRCN0000253072 ACCGAGAATACAATCAGTTTC pLKO_005 558 5UTR 100% 10.800 7.560 N Cspp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.