Transcript: Mouse XM_017319627.1

PREDICTED: Mus musculus inturned planar cell polarity protein (Intu), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Intu (380614)
Length:
6819
CDS:
582..3356

Additional Resources:

NCBI RefSeq record:
XM_017319627.1
NBCI Gene record:
Intu (380614)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252808 CACTATAGTACTCGTTAAATA pLKO_005 3458 3UTR 100% 15.000 21.000 N Intu n/a
2 TRCN0000216905 GGATTGGCCAGCTGATAATAT pLKO.1 2203 CDS 100% 15.000 21.000 N Intu n/a
3 TRCN0000252807 CGCACCTCGTCTGGATCATTT pLKO_005 1820 CDS 100% 13.200 18.480 N Intu n/a
4 TRCN0000252806 GGAACCTGAAGGGAGATATTT pLKO_005 2288 CDS 100% 15.000 10.500 N Intu n/a
5 TRCN0000252810 AGTTGGAAGTCTATGACATAA pLKO_005 2872 CDS 100% 13.200 9.240 N Intu n/a
6 TRCN0000252809 GAGCATTCGGAGCCTACAAAT pLKO_005 3111 CDS 100% 13.200 9.240 N Intu n/a
7 TRCN0000191191 CGTTAAATACTGAGATGCAAT pLKO.1 3470 3UTR 100% 4.950 3.465 N Intu n/a
8 TRCN0000079943 CCTGCTTTCTTATAGAACCAA pLKO.1 4902 3UTR 100% 3.000 1.500 Y Spint1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.