Transcript: Mouse XM_017319729.1

PREDICTED: Mus musculus threonyl-tRNA synthetase 2, mitochondrial (putative) (Tars2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tars2 (71807)
Length:
2448
CDS:
797..2251

Additional Resources:

NCBI RefSeq record:
XM_017319729.1
NBCI Gene record:
Tars2 (71807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348820 GAACGTACGCACGCGAGATAA pLKO_005 2137 CDS 100% 13.200 18.480 N Tars2 n/a
2 TRCN0000102372 CGGTGTGTTTACTCGGTTCTT pLKO.1 1532 CDS 100% 4.950 6.930 N Tars2 n/a
3 TRCN0000352009 CGGTGTGTTTACTCGGTTCTT pLKO_005 1532 CDS 100% 4.950 6.930 N Tars2 n/a
4 TRCN0000102371 GCCCACTACAACTTTCAGTTT pLKO.1 2081 CDS 100% 4.950 3.960 N Tars2 n/a
5 TRCN0000102374 GCAGAGTCAAAGGACAGTGAA pLKO.1 2119 CDS 100% 4.950 3.465 N Tars2 n/a
6 TRCN0000102373 GCCTTGGAGAAGTTTGGAGAA pLKO.1 1646 CDS 100% 4.050 2.835 N Tars2 n/a
7 TRCN0000352088 GCCTTGGAGAAGTTTGGAGAA pLKO_005 1646 CDS 100% 4.050 2.835 N Tars2 n/a
8 TRCN0000102370 GTCATGTCCATTGGTGATGTA pLKO.1 2252 CDS 100% 4.950 2.970 N Tars2 n/a
9 TRCN0000352010 GTCATGTCCATTGGTGATGTA pLKO_005 2252 CDS 100% 4.950 2.970 N Tars2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.