Transcript: Mouse XM_017319778.1

PREDICTED: Mus musculus family with sequence similarity 63, member A (Fam63a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mindy1 (75007)
Length:
2537
CDS:
696..2102

Additional Resources:

NCBI RefSeq record:
XM_017319778.1
NBCI Gene record:
Mindy1 (75007)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319778.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173516 GACTTTGAGTATACGCCGGAA pLKO.1 1350 CDS 100% 2.160 3.024 N Mindy1 n/a
2 TRCN0000345863 GACTTTGAGTATACGCCGGAA pLKO_005 1350 CDS 100% 2.160 3.024 N Mindy1 n/a
3 TRCN0000174865 GACACAGAGAATAACCTATAT pLKO.1 2166 3UTR 100% 13.200 9.240 N Mindy1 n/a
4 TRCN0000345864 GACACAGAGAATAACCTATAT pLKO_005 2166 3UTR 100% 13.200 9.240 N Mindy1 n/a
5 TRCN0000215909 CTTAGTGTCTTCTTTCGAAAC pLKO.1 1626 CDS 100% 6.000 4.200 N Mindy1 n/a
6 TRCN0000194084 GAGGGCCTTCAACTTAACTTT pLKO.1 1245 CDS 100% 5.625 3.938 N Mindy1 n/a
7 TRCN0000215718 CAACAAGAAGAGTATCAACAA pLKO.1 1956 CDS 100% 4.950 3.465 N Mindy1 n/a
8 TRCN0000174963 GAATAACCTATATGCACTGTT pLKO.1 2174 3UTR 100% 4.950 3.465 N Mindy1 n/a
9 TRCN0000345788 GAATAACCTATATGCACTGTT pLKO_005 2174 3UTR 100% 4.950 3.465 N Mindy1 n/a
10 TRCN0000173583 GCATCTTTGACTTGCTGGGAA pLKO.1 1375 CDS 100% 2.640 1.848 N Mindy1 n/a
11 TRCN0000175824 GCTATCTTCTCTTCCTCTCTT pLKO.1 2256 3UTR 100% 4.950 2.970 N Mindy1 n/a
12 TRCN0000345789 GCTATCTTCTCTTCCTCTCTT pLKO_005 2256 3UTR 100% 4.950 2.970 N Mindy1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319778.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.