Transcript: Mouse XM_017319812.2

PREDICTED: Mus musculus chloride channel accessory 3A2 (Clca3a2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Clca3a2 (80797)
Length:
2660
CDS:
111..2543

Additional Resources:

NCBI RefSeq record:
XM_017319812.2
NBCI Gene record:
Clca3a2 (80797)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319812.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069709 CAAACATGTAAGCAGCCTTAT pLKO.1 1541 CDS 100% 10.800 7.560 N Clca3a2 n/a
2 TRCN0000069708 CGCCAGCATCACAGGCAAGAA pLKO.1 716 CDS 100% 1.650 1.155 N Clca3a2 n/a
3 TRCN0000069710 GCCATCATAGAAGCTGAACAT pLKO.1 2049 CDS 100% 4.950 2.970 N Clca3a2 n/a
4 TRCN0000069328 GCTGAGTTTATAGGTGATTAT pLKO.1 2448 CDS 100% 13.200 6.600 Y Clca3a1 n/a
5 TRCN0000069712 CCAGAAATCATTCTTCAAGAT pLKO.1 1734 CDS 100% 4.950 2.475 Y Clca3a2 n/a
6 TRCN0000069331 CCAAGCATAAAGGAAATGGTA pLKO.1 300 CDS 100% 3.000 1.500 Y Clca3a1 n/a
7 TRCN0000069329 GCCTCCATAATGTTCATGCAA pLKO.1 855 CDS 100% 3.000 1.500 Y Clca3a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319812.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.