Transcript: Mouse XM_017319841.1

PREDICTED: Mus musculus transmembrane protein 56 (Tmem56), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem56 (99887)
Length:
1077
CDS:
562..1077

Additional Resources:

NCBI RefSeq record:
XM_017319841.1
NBCI Gene record:
Tmem56 (99887)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422600 GAAAGTGATCGGCGACAAATT pLKO_005 930 CDS 100% 13.200 18.480 N Tmem56 n/a
2 TRCN0000415968 CAAGAGTTTCTTCAGGTTATA pLKO_005 695 CDS 100% 13.200 9.240 N Tmem56 n/a
3 TRCN0000173188 CCACTCTTTGTTAGTTGGGAT pLKO.1 771 CDS 100% 2.640 1.848 N Tmem56 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.