Transcript: Mouse XM_017319853.1

PREDICTED: Mus musculus tensin 1 (Tns1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tns1 (21961)
Length:
10043
CDS:
16..5745

Additional Resources:

NCBI RefSeq record:
XM_017319853.1
NBCI Gene record:
Tns1 (21961)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319853.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030455 CACAGCCAATGAGGAGAACTT pLKO.1 627 CDS 100% 4.950 3.465 N Tns1 n/a
2 TRCN0000030458 GCTCAGATGTTGAAGTCCAAG pLKO.1 670 CDS 100% 4.050 2.835 N Tns1 n/a
3 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8289 3UTR 100% 4.950 2.475 Y KAAG1 n/a
4 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 8293 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319853.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.