Transcript: Mouse XM_017319904.1

PREDICTED: Mus musculus zinc finger protein 501-like (LOC101056073), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC101056073 (101056073)
Length:
2356
CDS:
86..1651

Additional Resources:

NCBI RefSeq record:
XM_017319904.1
NBCI Gene record:
LOC101056073 (101056073)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319904.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245416 ATGAGTGTGTATCTGGTAAAT pLKO_005 86 CDS 100% 13.200 7.920 N Gm13225 n/a
2 TRCN0000239768 CAGCTCTGACTCTCTTCAATA pLKO_005 403 CDS 100% 13.200 7.920 N Gm13225 n/a
3 TRCN0000239770 ACCTCACAAATGTAGTCAATG pLKO_005 883 CDS 100% 10.800 6.480 N Gm13225 n/a
4 TRCN0000239769 TAGTGTCAATCAAGGAATTTA pLKO_005 514 CDS 100% 15.000 7.500 Y Gm13225 n/a
5 TRCN0000429213 AGGAATGGGAATGTCTCAATT pLKO_005 159 CDS 100% 13.200 6.600 Y Rex2 n/a
6 TRCN0000235185 ATGACTCTGTAAACAGTTTAA pLKO_005 477 CDS 100% 13.200 6.600 Y Gm8935 n/a
7 TRCN0000086300 CAGGAGAGAAACCTTACAAAT pLKO.1 1125 CDS 100% 13.200 6.600 Y Znf41-ps n/a
8 TRCN0000235353 CAGGAGAGAAACCTTACAAAT pLKO_005 1125 CDS 100% 13.200 6.600 Y EG666605 n/a
9 TRCN0000239790 CATCAGATCCATCTTAGTATT pLKO_005 752 CDS 100% 13.200 6.600 Y Zfp985 n/a
10 TRCN0000239545 CCTTACAAATGTAGTGAATTT pLKO_005 632 CDS 100% 13.200 6.600 Y Gm13212 n/a
11 TRCN0000239767 CTTAAACCCAGGAACACTAAA pLKO_005 440 CDS 100% 13.200 6.600 Y Gm13225 n/a
12 TRCN0000431848 GATGTGATGTTGGAGAATTAC pLKO_005 203 CDS 100% 13.200 6.600 Y Rex2 n/a
13 TRCN0000240210 TAGATTGTATGTGACAAATAC pLKO_005 1649 CDS 100% 13.200 6.600 Y Zfp988 n/a
14 TRCN0000240212 TGACTCTGTAAACAGTTTAAG pLKO_005 478 CDS 100% 13.200 6.600 Y Zfp988 n/a
15 TRCN0000239789 TGTGACAAATGCTTTACTAAA pLKO_005 1406 CDS 100% 13.200 6.600 Y Zfp985 n/a
16 TRCN0000418910 ACCTTACAAATGTAGTGAATG pLKO_005 1135 CDS 100% 10.800 5.400 Y Rex2 n/a
17 TRCN0000086299 CCAGGAACACTAAAGAAGTTT pLKO.1 447 CDS 100% 5.625 2.813 Y Znf41-ps n/a
18 TRCN0000086298 GCAAATACAATGACTCTGTAA pLKO.1 468 CDS 100% 4.950 2.475 Y Znf41-ps n/a
19 TRCN0000240041 TGACTCTGTAAACAGTTTAAC pLKO_005 478 CDS 100% 13.200 6.600 Y Zfp991 n/a
20 TRCN0000240039 TGATGTTGGAGAATTACAATA pLKO_005 207 CDS 100% 13.200 6.600 Y Zfp991 n/a
21 TRCN0000272258 TCTAAATGGGACAAGCTTATC pLKO_005 335 CDS 100% 10.800 5.400 Y Zfp984 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319904.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.