Transcript: Mouse XM_017319909.1

PREDICTED: Mus musculus collagen, type XVI, alpha 1 (Col16a1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Col16a1 (107581)
Length:
5147
CDS:
259..4962

Additional Resources:

NCBI RefSeq record:
XM_017319909.1
NBCI Gene record:
Col16a1 (107581)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090359 CCGGAACACATGGTACTTGTT pLKO.1 597 CDS 100% 4.950 3.960 N Col16a1 n/a
2 TRCN0000303848 ATGGGAGACATGGTGAATTAT pLKO_005 4435 CDS 100% 15.000 10.500 N COL16A1 n/a
3 TRCN0000090358 GAAGGACTCTACTAGGAATAA pLKO.1 4984 3UTR 100% 13.200 9.240 N Col16a1 n/a
4 TRCN0000303849 ATGAGCTCATTGAGATCAATC pLKO_005 1040 CDS 100% 10.800 7.560 N COL16A1 n/a
5 TRCN0000090361 GCAGCTCATGGGAAGAAACAT pLKO.1 1131 CDS 100% 5.625 3.938 N Col16a1 n/a
6 TRCN0000090360 GAGGTTTATCAGACAAGAGAT pLKO.1 4467 CDS 100% 4.950 3.465 N Col16a1 n/a
7 TRCN0000090362 CCAGCAAGGTATTCCTGGGAT pLKO.1 4812 CDS 100% 2.640 1.848 N Col16a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.