Transcript: Mouse XM_017319919.1

PREDICTED: Mus musculus zinc finger protein 979 (Zfp979), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Zfp979 (112422)
Length:
2337
CDS:
182..1246

Additional Resources:

NCBI RefSeq record:
XM_017319919.1
NBCI Gene record:
Zfp979 (112422)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429213 AGGAATGGGAATGTCTCAATT pLKO_005 141 5UTR 100% 13.200 6.600 Y Rex2 n/a
2 TRCN0000095193 CACCAAGTTAGTCTGAGTATT pLKO.1 992 CDS 100% 13.200 6.600 Y Zfp979 n/a
3 TRCN0000086300 CAGGAGAGAAACCTTACAAAT pLKO.1 1113 CDS 100% 13.200 6.600 Y Znf41-ps n/a
4 TRCN0000235353 CAGGAGAGAAACCTTACAAAT pLKO_005 1113 CDS 100% 13.200 6.600 Y EG666605 n/a
5 TRCN0000416415 CTTACACTTGTGGTGAATTTG pLKO_005 621 CDS 100% 13.200 6.600 Y Rex2 n/a
6 TRCN0000431848 GATGTGATGTTGGAGAATTAC pLKO_005 185 CDS 100% 13.200 6.600 Y Rex2 n/a
7 TRCN0000095190 CCACCAAGTTAGTCTGAGTAT pLKO.1 991 CDS 100% 4.950 2.475 Y Zfp979 n/a
8 TRCN0000084458 GCACATATAAAGACTGTGTAA pLKO.1 456 CDS 100% 4.950 2.475 Y Rex2 n/a
9 TRCN0000095191 CCACCAAGTTAGTCTGCGTAT pLKO.1 1159 CDS 100% 4.050 2.025 Y Zfp979 n/a
10 TRCN0000095192 CCCACCAAGTTAGTCTGCGTA pLKO.1 1158 CDS 100% 2.640 1.320 Y Zfp979 n/a
11 TRCN0000239545 CCTTACAAATGTAGTGAATTT pLKO_005 956 CDS 100% 13.200 6.600 Y Gm13212 n/a
12 TRCN0000240039 TGATGTTGGAGAATTACAATA pLKO_005 189 CDS 100% 13.200 6.600 Y Zfp991 n/a
13 TRCN0000095189 CGAATGTTGTATATGTGACAT pLKO.1 1381 3UTR 100% 4.950 2.475 Y Zfp979 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.