Transcript: Mouse XM_017319920.1

PREDICTED: Mus musculus microtubule-actin crosslinking factor 1 (Macf1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Macf1 (11426)
Length:
21273
CDS:
3277..20100

Additional Resources:

NCBI RefSeq record:
XM_017319920.1
NBCI Gene record:
Macf1 (11426)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089573 CGGTGTGTAAACTCTCTGTTT pLKO.1 18053 CDS 100% 4.950 6.930 N Macf1 n/a
2 TRCN0000089575 CCAGTGAGATTCGGTCTGATT pLKO.1 11663 CDS 100% 4.950 3.960 N Macf1 n/a
3 TRCN0000089577 CCAGGGTGAATTGATGTTAAA pLKO.1 16323 CDS 100% 13.200 9.240 N Macf1 n/a
4 TRCN0000055845 GCTGAGTATAAAGTGGTGAAA pLKO.1 13594 CDS 100% 4.950 3.465 N MACF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.