Transcript: Mouse XM_017319922.1

PREDICTED: Mus musculus angiotensin II, type I receptor-associated protein (Agtrap), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Agtrap (11610)
Length:
4073
CDS:
336..656

Additional Resources:

NCBI RefSeq record:
XM_017319922.1
NBCI Gene record:
Agtrap (11610)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120912 CCTCTGAATCTAAGTGACTAT pLKO.1 1354 3UTR 100% 4.950 3.960 N Agtrap n/a
2 TRCN0000120916 TCCTGGACATTATCTACATTA pLKO.1 367 CDS 100% 13.200 9.240 N Agtrap n/a
3 TRCN0000120915 ACCAGACAATTGACTCATCAT pLKO.1 568 CDS 100% 4.950 3.465 N Agtrap n/a
4 TRCN0000120913 CCTACCAGACAATTGACTCAT pLKO.1 565 CDS 100% 4.950 3.465 N Agtrap n/a
5 TRCN0000120914 CTTGGTGTTCTCAAGCTCCTA pLKO.1 239 5UTR 100% 2.640 1.848 N Agtrap n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 3663 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.