Transcript: Mouse XM_017319944.1

PREDICTED: Mus musculus colony stimulating factor 3 receptor (granulocyte) (Csf3r), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csf3r (12986)
Length:
4196
CDS:
1084..3597

Additional Resources:

NCBI RefSeq record:
XM_017319944.1
NBCI Gene record:
Csf3r (12986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067128 GCTGTGGACACATCGAGATTT pLKO.1 1157 CDS 100% 13.200 9.240 N Csf3r n/a
2 TRCN0000089036 CCCAGGAGTAATGCAGTACAT pLKO.1 3369 CDS 100% 4.950 3.465 N EG433259 n/a
3 TRCN0000067130 CCCAGTCTACACCCTACAGAT pLKO.1 1986 CDS 100% 4.950 3.465 N Csf3r n/a
4 TRCN0000067131 GACTGGAGTTACCCTGATCTT pLKO.1 1110 CDS 100% 4.950 3.465 N Csf3r n/a
5 TRCN0000067129 GCAAACGCAGAGGAAAGACTT pLKO.1 3032 CDS 100% 4.950 3.465 N Csf3r n/a
6 TRCN0000067132 GCTGAGCTTCACGCAGGCTAT pLKO.1 1429 CDS 100% 1.350 0.945 N Csf3r n/a
7 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 4092 3UTR 100% 4.950 2.475 Y Gad2 n/a
8 TRCN0000089033 CCCAATGGTCACCATTCGTAT pLKO.1 3808 3UTR 100% 4.950 3.465 N EG433259 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.