Transcript: Mouse XM_017319958.1

PREDICTED: Mus musculus diencephalon/mesencephalon homeobox 1 (Dmbx1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dmbx1 (140477)
Length:
4131
CDS:
154..1299

Additional Resources:

NCBI RefSeq record:
XM_017319958.1
NBCI Gene record:
Dmbx1 (140477)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319958.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081994 CCTGATGCACTACTCGTCTTT pLKO.1 984 CDS 100% 4.950 6.930 N Dmbx1 n/a
2 TRCN0000081996 CCAGTCCTATTACCAATCCCT pLKO.1 1101 CDS 100% 0.750 1.050 N Dmbx1 n/a
3 TRCN0000423774 TTTCACCTTGTCTCCCTTATT pLKO_005 1430 3UTR 100% 13.200 10.560 N Dmbx1 n/a
4 TRCN0000413027 CGCCTAGCTGGCTGTACATTT pLKO_005 298 CDS 100% 13.200 9.240 N Dmbx1 n/a
5 TRCN0000081997 CAGGGCCAAGTTCCGAAAGAA pLKO.1 519 CDS 100% 5.625 3.938 N Dmbx1 n/a
6 TRCN0000016568 CTGTACATTTCAAGACATCAT pLKO.1 309 CDS 100% 4.950 3.465 N DMBX1 n/a
7 TRCN0000016570 GAACTCACTCAGCGCCATGTA pLKO.1 195 CDS 100% 4.950 3.465 N DMBX1 n/a
8 TRCN0000081993 GCTCTCCAAGTTCTCCTAGAA pLKO.1 1370 3UTR 100% 4.950 3.465 N Dmbx1 n/a
9 TRCN0000081995 GCCATGTGTACCAATCTTCCT pLKO.1 466 CDS 100% 2.640 1.848 N Dmbx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319958.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.