Transcript: Mouse XM_017319974.1

PREDICTED: Mus musculus fatty acid amide hydrolase (Faah), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Faah (14073)
Length:
5037
CDS:
1039..3219

Additional Resources:

NCBI RefSeq record:
XM_017319974.1
NBCI Gene record:
Faah (14073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416814 CCCTTCGTGTGGGATACTATG pLKO_005 2009 CDS 100% 10.800 15.120 N Faah n/a
2 TRCN0000423804 CTAAGCTATGACTGCAGTAAC pLKO_005 1612 CDS 100% 10.800 15.120 N Faah n/a
3 TRCN0000101475 GCAGATTTATTTCTAGCGAAT pLKO.1 4301 3UTR 100% 4.050 5.670 N Faah n/a
4 TRCN0000101478 GCTCTTTACCTACCTGGGAAA pLKO.1 1326 CDS 100% 4.050 5.670 N Faah n/a
5 TRCN0000435663 TGTATCGCCAGTCCGTCATTG pLKO_005 2837 CDS 100% 10.800 8.640 N Faah n/a
6 TRCN0000431006 TGAACAAAGGGACCAACTGTG pLKO_005 1358 CDS 100% 4.050 3.240 N FAAH n/a
7 TRCN0000428627 CAGCTACACTGTTCTCTATAA pLKO_005 2952 CDS 100% 13.200 9.240 N Faah n/a
8 TRCN0000101477 CCCTTCTTACCAAACAACATA pLKO.1 2122 CDS 100% 5.625 3.938 N Faah n/a
9 TRCN0000101476 GCCCAGATGGAACACTACAAA pLKO.1 3031 CDS 100% 5.625 3.938 N Faah n/a
10 TRCN0000101479 GCATTGTGCATGAAAGCCCTA pLKO.1 1909 CDS 100% 2.160 1.296 N Faah n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.