Transcript: Mouse XM_017320160.1

PREDICTED: Mus musculus noncompact myelin associated protein (Ncmap), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ncmap (230822)
Length:
1677
CDS:
382..684

Additional Resources:

NCBI RefSeq record:
XM_017320160.1
NBCI Gene record:
Ncmap (230822)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265045 GAGAGGACGCCCTGTATAAGA pLKO_005 437 CDS 100% 5.625 7.875 N Ncmap n/a
2 TRCN0000265044 CCGTCTTCTCGCTGAACATGA pLKO_005 410 CDS 100% 4.950 6.930 N Ncmap n/a
3 TRCN0000283266 GACGGCTAGACAGCTTGATAG pLKO_005 968 3UTR 100% 10.800 8.640 N Ncmap n/a
4 TRCN0000191831 GAAACTAACTTGGACTAACTA pLKO.1 1115 3UTR 100% 5.625 4.500 N Ncmap n/a
5 TRCN0000265043 GATCCTGCTGAAGATGTACAA pLKO_005 519 CDS 100% 4.950 3.465 N Ncmap n/a
6 TRCN0000201940 CATCATTGTCACCTTGGTGCT pLKO.1 498 CDS 100% 2.160 1.512 N Ncmap n/a
7 TRCN0000162209 CTGAAGATGTACAACAGGAAA pLKO.1 526 CDS 100% 4.950 3.465 N NCMAP n/a
8 TRCN0000163334 GCTGAAGATGTACAACAGGAA pLKO.1 525 CDS 100% 2.640 1.848 N NCMAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.