Transcript: Mouse XM_017320263.1

PREDICTED: Mus musculus chromodomain helicase DNA binding protein 7 (Chd7), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chd7 (320790)
Length:
7361
CDS:
1995..7250

Additional Resources:

NCBI RefSeq record:
XM_017320263.1
NBCI Gene record:
Chd7 (320790)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238672 ACTGTCGATATGCCGAGTTAT pLKO_005 6060 CDS 100% 13.200 18.480 N Chd7 n/a
2 TRCN0000238673 TGTGGAAGTTGACCGGATAAT pLKO_005 1077 5UTR 100% 13.200 10.560 N Chd7 n/a
3 TRCN0000016411 CGGACCATTCAGTTGTATGAA pLKO.1 1594 5UTR 100% 5.625 4.500 N CHD7 n/a
4 TRCN0000238670 CTGTCCTGAGCTGCGTAATAT pLKO_005 1704 5UTR 100% 15.000 10.500 N Chd7 n/a
5 TRCN0000234550 GAGAGTTCCAGGGAGTATAAA pLKO_005 1303 5UTR 100% 15.000 10.500 N CHD7 n/a
6 TRCN0000238674 GAGAGTTCCAGGGAGTATAAA pLKO_005 1303 5UTR 100% 15.000 10.500 N Chd7 n/a
7 TRCN0000234552 GCCTATCAGCGCAGCTATAAA pLKO_005 4017 CDS 100% 15.000 10.500 N CHD7 n/a
8 TRCN0000238671 GCCTATCAGCGCAGCTATAAA pLKO_005 4017 CDS 100% 15.000 10.500 N Chd7 n/a
9 TRCN0000016412 CGCCAGATGTTTGATTTCCAA pLKO.1 5265 CDS 100% 3.000 2.100 N CHD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.