Transcript: Mouse XM_017320299.1

PREDICTED: Mus musculus predicted gene 13212 (Gm13212), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm13212 (433801)
Length:
3733
CDS:
398..2782

Additional Resources:

NCBI RefSeq record:
XM_017320299.1
NBCI Gene record:
Gm13212 (433801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239543 ACAGGAGAGAAACCTTATAAA pLKO_005 2591 CDS 100% 15.000 7.500 Y Gm13212 n/a
2 TRCN0000284687 TACAGGAGAGAAACCTTATAA pLKO_005 2590 CDS 100% 15.000 7.500 Y Zfp984 n/a
3 TRCN0000086300 CAGGAGAGAAACCTTACAAAT pLKO.1 1248 CDS 100% 13.200 6.600 Y Znf41-ps n/a
4 TRCN0000235353 CAGGAGAGAAACCTTACAAAT pLKO_005 1248 CDS 100% 13.200 6.600 Y EG666605 n/a
5 TRCN0000239545 CCTTACAAATGTAGTGAATTT pLKO_005 923 CDS 100% 13.200 6.600 Y Gm13212 n/a
6 TRCN0000235184 CTTAAGCCCAGGAACACTAAA pLKO_005 731 CDS 100% 13.200 6.600 Y Gm8935 n/a
7 TRCN0000245298 CTTAAGCCCAGGAACACTAAA pLKO_005 731 CDS 100% 13.200 6.600 Y Zfp987 n/a
8 TRCN0000239789 TGTGACAAATGCTTTACTAAA pLKO_005 1445 CDS 100% 13.200 6.600 Y Zfp985 n/a
9 TRCN0000418910 ACCTTACAAATGTAGTGAATG pLKO_005 1258 CDS 100% 10.800 5.400 Y Rex2 n/a
10 TRCN0000239786 TTAAGCCCAGGAACACTAAAG pLKO_005 732 CDS 100% 10.800 5.400 Y Zfp985 n/a
11 TRCN0000086299 CCAGGAACACTAAAGAAGTTT pLKO.1 738 CDS 100% 5.625 2.813 Y Znf41-ps n/a
12 TRCN0000086298 GCAAATACAATGACTCTGTAA pLKO.1 759 CDS 100% 4.950 2.475 Y Znf41-ps n/a
13 TRCN0000239790 CATCAGATCCATCTTAGTATT pLKO_005 1043 CDS 100% 13.200 6.600 Y Zfp985 n/a
14 TRCN0000272258 TCTAAATGGGACAAGCTTATC pLKO_005 632 CDS 100% 10.800 5.400 Y Zfp984 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.