Transcript: Mouse XM_017320305.1

PREDICTED: Mus musculus zinc finger, DHHC domain containing 18 (Zdhhc18), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zdhhc18 (503610)
Length:
1277
CDS:
92..1264

Additional Resources:

NCBI RefSeq record:
XM_017320305.1
NBCI Gene record:
Zdhhc18 (503610)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125659 CCTGACAACTAACGAAGATAT pLKO.1 985 CDS 100% 13.200 18.480 N Zdhhc18 n/a
2 TRCN0000125661 AGACGGAACTACCGCTTCTTT pLKO.1 758 CDS 100% 5.625 7.875 N Zdhhc18 n/a
3 TRCN0000125660 GCAGACAGTGAAACTCAAGTA pLKO.1 625 CDS 100% 4.950 3.465 N Zdhhc18 n/a
4 TRCN0000125662 GACAACTGTGTGGAACGGTTT pLKO.1 701 CDS 100% 4.050 2.835 N Zdhhc18 n/a
5 TRCN0000125663 TGACCCTTCTTTCTCAAGGAA pLKO.1 843 CDS 100% 3.000 2.100 N Zdhhc18 n/a
6 TRCN0000165977 GCGTTTATTCTCTCCCTCTCA pLKO.1 782 CDS 100% 2.640 1.848 N ZDHHC18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.