Transcript: Mouse XM_017320458.1

PREDICTED: Mus musculus sperm tail PG rich repeat containing 1 (Stpg1), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stpg1 (78806)
Length:
2293
CDS:
636..1247

Additional Resources:

NCBI RefSeq record:
XM_017320458.1
NBCI Gene record:
Stpg1 (78806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177946 GCAATCGCCAAAGTTCTTAAT pLKO.1 845 CDS 100% 13.200 18.480 N Stpg1 n/a
2 TRCN0000181351 CCTCAGCTATGCCTTGTTATT pLKO.1 1655 3UTR 100% 13.200 10.560 N Stpg1 n/a
3 TRCN0000217039 CTATCCCAGACACTGATAATG pLKO.1 2010 3UTR 100% 13.200 9.240 N Stpg1 n/a
4 TRCN0000217020 CAAGAAGGACTTCAGCAATTC pLKO.1 605 5UTR 100% 10.800 7.560 N Stpg1 n/a
5 TRCN0000178620 CCGAATGATCAAACCAAGATT pLKO.1 939 CDS 100% 5.625 3.938 N Stpg1 n/a
6 TRCN0000177510 CTCTACAATGAAGACAACAAA pLKO.1 1209 CDS 100% 5.625 3.938 N Stpg1 n/a
7 TRCN0000200131 CAAGAGAGGAACGTGCACTTT pLKO.1 500 5UTR 100% 4.950 3.465 N Stpg1 n/a
8 TRCN0000182829 CAGAGATTCCAGGGAAGCAAT pLKO.1 1183 CDS 100% 4.950 3.465 N Stpg1 n/a
9 TRCN0000217542 CAGTATGAGATCGTGAACTAC pLKO.1 1053 CDS 100% 4.950 3.465 N Stpg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.