Transcript: Mouse XM_017320573.1

PREDICTED: Mus musculus leucine rich repeat containing 8 family, member C (Lrrc8c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrc8c (100604)
Length:
7141
CDS:
484..2895

Additional Resources:

NCBI RefSeq record:
XM_017320573.1
NBCI Gene record:
Lrrc8c (100604)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320573.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215666 GATGAAAGCAGACTAACTTAT pLKO.1 2880 CDS 100% 13.200 18.480 N Lrrc8c n/a
2 TRCN0000174428 CCTAATCATCATTGCCTACAA pLKO.1 1302 CDS 100% 4.950 6.930 N Lrrc8c n/a
3 TRCN0000175715 GCTCCATATGATAGACCAGTA pLKO.1 1602 CDS 100% 0.000 0.000 N Lrrc8c n/a
4 TRCN0000193710 CGGAGTGTTTGGATGTACTTT pLKO.1 597 CDS 100% 5.625 4.500 N Lrrc8c n/a
5 TRCN0000173666 CGCTTACATTCCAGAGCACAT pLKO.1 2430 CDS 100% 4.050 3.240 N Lrrc8c n/a
6 TRCN0000216763 GGGAATATTCCTTCGAGTATG pLKO.1 1523 CDS 100% 10.800 7.560 N Lrrc8c n/a
7 TRCN0000173682 CCGAAATCGGAGTTCTGCAAA pLKO.1 2582 CDS 100% 4.950 3.465 N Lrrc8c n/a
8 TRCN0000193468 GTACAGTTTCATCAACCAGAT pLKO.1 804 CDS 100% 4.050 2.835 N Lrrc8c n/a
9 TRCN0000193590 GAAACATGCTTCTACCAAATA pLKO.1 2920 3UTR 100% 13.200 7.920 N Lrrc8c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320573.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.