Transcript: Mouse XM_017320669.1

PREDICTED: Mus musculus G protein-coupled receptor kinase 4 (Grk4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grk4 (14772)
Length:
2346
CDS:
390..2093

Additional Resources:

NCBI RefSeq record:
XM_017320669.1
NBCI Gene record:
Grk4 (14772)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320669.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368016 GTAGGAACATCTTGGATATTG pLKO_005 1810 CDS 100% 13.200 18.480 N Grk4 n/a
2 TRCN0000022800 GCACCCAATATTCAAGGATAT pLKO.1 1721 CDS 100% 10.800 15.120 N Grk4 n/a
3 TRCN0000022801 GCCCGTCTAGGATTTAACAAA pLKO.1 432 CDS 100% 5.625 7.875 N Grk4 n/a
4 TRCN0000022802 GAAATCTTCTACGCTGAATTT pLKO.1 1875 CDS 100% 13.200 10.560 N Grk4 n/a
5 TRCN0000378521 GGGATTTGAAGTACCACATTT pLKO_005 1195 CDS 100% 13.200 10.560 N Grk4 n/a
6 TRCN0000361280 ATCATGGACACATCCGAATTT pLKO_005 1351 CDS 100% 13.200 9.240 N Grk4 n/a
7 TRCN0000022799 GCTCCAGAAATTATCAATCAT pLKO.1 1446 CDS 100% 5.625 3.938 N Grk4 n/a
8 TRCN0000022803 CCAAGAAAGTACCTACTTTAA pLKO.1 872 CDS 100% 1.320 0.924 N Grk4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320669.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.