Transcript: Mouse XM_017320686.1

PREDICTED: Mus musculus heparan sulfate (glucosamine) 3-O-sulfotransferase 1 (Hs3st1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hs3st1 (15476)
Length:
1494
CDS:
131..1066

Additional Resources:

NCBI RefSeq record:
XM_017320686.1
NBCI Gene record:
Hs3st1 (15476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320686.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381743 ACGCCTCGAACTTCTACTTTA pLKO_005 867 CDS 100% 13.200 18.480 N Hs3st1 n/a
2 TRCN0000382125 GGAGAAGACACCCGCCTATTT pLKO_005 493 CDS 100% 13.200 18.480 N Hs3st1 n/a
3 TRCN0000098197 CGCTGCTTACACGAGTCCAAA pLKO.1 932 CDS 100% 4.950 6.930 N Hs3st1 n/a
4 TRCN0000098196 GCCTATTTCACTTCGCCCAAA pLKO.1 506 CDS 100% 4.050 5.670 N Hs3st1 n/a
5 TRCN0000381543 ACATTCGACTGGCACTGATTT pLKO_005 1049 CDS 100% 13.200 10.560 N Hs3st1 n/a
6 TRCN0000098195 GAACTTAACTATTGCACTGAA pLKO.1 1318 3UTR 100% 4.950 3.960 N Hs3st1 n/a
7 TRCN0000379602 GATTCACAGTTGCCATATATA pLKO_005 1206 3UTR 100% 15.000 10.500 N Hs3st1 n/a
8 TRCN0000381552 AGCTTCTGAGGAAGGTGATTA pLKO_005 228 CDS 100% 13.200 9.240 N Hs3st1 n/a
9 TRCN0000098198 CGCCTCGAACTTCTACTTTAA pLKO.1 868 CDS 100% 13.200 9.240 N Hs3st1 n/a
10 TRCN0000382115 ACCCATTGAGGACCTCCTAAT pLKO_005 658 CDS 100% 10.800 7.560 N Hs3st1 n/a
11 TRCN0000098199 CGAATACTTTCATGAGCCAAA pLKO.1 1000 CDS 100% 4.050 2.835 N Hs3st1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320686.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.