Transcript: Mouse XM_017320695.1

PREDICTED: Mus musculus MAD1 mitotic arrest deficient 1-like 1 (Mad1l1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mad1l1 (17120)
Length:
1671
CDS:
335..1258

Additional Resources:

NCBI RefSeq record:
XM_017320695.1
NBCI Gene record:
Mad1l1 (17120)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273054 GATGACCAAGCCAGATCATAC pLKO_005 1487 3UTR 100% 10.800 7.560 N Mad1l1 n/a
2 TRCN0000012834 AGCTGAATCTAGCTTCTCATT pLKO.1 562 CDS 100% 4.950 3.465 N Mad1l1 n/a
3 TRCN0000273052 AGCTGAATCTAGCTTCTCATT pLKO_005 562 CDS 100% 4.950 3.465 N Mad1l1 n/a
4 TRCN0000012835 GACATGGTTCAGAAGGTACAT pLKO.1 422 CDS 100% 4.950 3.465 N Mad1l1 n/a
5 TRCN0000012833 CAGACCTCTATCTAGCCTCTT pLKO.1 1244 CDS 100% 4.050 2.835 N Mad1l1 n/a
6 TRCN0000273053 CAGACCTCTATCTAGCCTCTT pLKO_005 1244 CDS 100% 4.050 2.835 N Mad1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.