Transcript: Mouse XM_017320805.1

PREDICTED: Mus musculus zonadhesin (Zan), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Zan (22635)
Length:
16481
CDS:
138..16436

Additional Resources:

NCBI RefSeq record:
XM_017320805.1
NBCI Gene record:
Zan (22635)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111177 CGTATGAACTACTATCTCATA pLKO.1 14877 CDS 100% 0.495 0.693 N Zan n/a
2 TRCN0000111176 CCTGGCTATGTGGTGCATAAT pLKO.1 12795 CDS 100% 13.200 17.160 N Zan n/a
3 TRCN0000111178 GCACCGAAATCACTCTACAAT pLKO.1 10099 CDS 100% 5.625 7.313 N Zan n/a
4 TRCN0000111179 CCCTGGTAATGGCTACTACAT pLKO.1 914 CDS 100% 4.950 3.465 N Zan n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.