Transcript: Mouse XM_017320949.1

PREDICTED: Mus musculus NEDD4 binding protein 2-like 2 (N4bp2l2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
N4bp2l2 (381695)
Length:
6739
CDS:
317..2443

Additional Resources:

NCBI RefSeq record:
XM_017320949.1
NBCI Gene record:
N4bp2l2 (381695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242267 AGGGAGATCTCCAGTTATAAT pLKO_005 388 CDS 100% 15.000 21.000 N N4bp2l2 n/a
2 TRCN0000028302 GCTACGAATTTCAAATGTCCA pLKO.1 585 CDS 100% 2.640 3.696 N N4bp2l2 n/a
3 TRCN0000242270 CTATGATGTGACTAGCAATAA pLKO_005 54 5UTR 100% 13.200 10.560 N N4bp2l2 n/a
4 TRCN0000216335 GTTTGATCAGAACGATGAATA pLKO.1 27 5UTR 100% 13.200 9.240 N N4bp2l2 n/a
5 TRCN0000191651 GCAATAATGTTCATCCCTTTA pLKO.1 68 5UTR 100% 10.800 7.560 N N4bp2l2 n/a
6 TRCN0000028251 GTCCATCTCCATTGTGATGAA pLKO.1 601 CDS 100% 4.950 3.465 N N4bp2l2 n/a
7 TRCN0000028237 CCGGAAACTTGGTGGAAGTTT pLKO.1 494 CDS 100% 0.563 0.394 N N4bp2l2 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4818 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.