Transcript: Mouse XM_017321099.1

PREDICTED: Mus musculus ribokinase (Rbks), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbks (71336)
Length:
941
CDS:
373..897

Additional Resources:

NCBI RefSeq record:
XM_017321099.1
NBCI Gene record:
Rbks (71336)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078933 GCCTCCATAATTGTCAATAAT pLKO.1 253 5UTR 100% 15.000 21.000 N Rbks n/a
2 TRCN0000078936 GTGATGATATGCCAGCTAGAA pLKO.1 370 5UTR 100% 4.950 6.930 N Rbks n/a
3 TRCN0000078934 TCAATAATGAAGGCCAGAATA pLKO.1 266 5UTR 100% 13.200 9.240 N Rbks n/a
4 TRCN0000078937 TGATGATATGCCAGCTAGAAA pLKO.1 371 5UTR 100% 5.625 3.938 N Rbks n/a
5 TRCN0000078935 CCAAAGCACATTCCCACTGAA pLKO.1 679 CDS 100% 4.950 3.465 N Rbks n/a
6 TRCN0000195544 CATAGTGGCTGGAGCAAATTT pLKO.1 294 5UTR 100% 15.000 21.000 N RBKS n/a
7 TRCN0000279958 CATAGTGGCTGGAGCAAATTT pLKO_005 294 5UTR 100% 15.000 21.000 N RBKS n/a
8 TRCN0000199478 GCCTTCTACCTGGCTTACTAT pLKO.1 754 CDS 100% 5.625 3.938 N RBKS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.