Transcript: Mouse XM_017321141.1

PREDICTED: Mus musculus guanylate-binding protein 8 (Gbp8), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gbp8 (76074)
Length:
4016
CDS:
387..1580

Additional Resources:

NCBI RefSeq record:
XM_017321141.1
NBCI Gene record:
Gbp8 (76074)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115035 CACCAAATCCTGATGGAATAA pLKO.1 466 CDS 100% 13.200 9.240 N Gbp8 n/a
2 TRCN0000115033 GATTCCCTGGAGAAACTACAT pLKO.1 405 CDS 100% 4.950 3.465 N Gbp8 n/a
3 TRCN0000115031 GCACAGACAATGCTTGCCTTT pLKO.1 1756 3UTR 100% 4.050 2.025 Y Gbp8 n/a
4 TRCN0000115040 CCAGACTTTGTCTGGACTGTT pLKO.1 516 CDS 100% 0.495 0.248 Y Gbp9 n/a
5 TRCN0000115032 CCACAATGAACATCTGTCCAT pLKO.1 172 5UTR 100% 2.640 1.848 N Gbp8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.