Transcript: Mouse XM_017321339.1

PREDICTED: Mus musculus vomeronasal 1 receptor 14 (Vmn1r14), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vmn1r14 (113864)
Length:
891
CDS:
1..891

Additional Resources:

NCBI RefSeq record:
XM_017321339.1
NBCI Gene record:
Vmn1r14 (113864)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120192 GATCAGTCATAGGAACTCTTT pLKO.1 312 CDS 100% 4.950 3.465 N Vmn1r14 n/a
2 TRCN0000120193 GATTATGTACTGGGTGGACTT pLKO.1 714 CDS 100% 4.050 2.430 N Vmn1r14 n/a
3 TRCN0000120194 TGTTCCTTGCTGGAGAGAATT pLKO.1 155 CDS 100% 0.000 0.000 N Vmn1r14 n/a
4 TRCN0000250950 ACTTGGAGTCCTAGCCAATAT pLKO_005 39 CDS 100% 13.200 6.600 Y Vmn1r9 n/a
5 TRCN0000203328 CAACTGACCTTTGTTCACATA pLKO.1 130 CDS 100% 4.950 2.475 Y Vmn1r9 n/a
6 TRCN0000120196 CATGCTGACTACAAGCACATA pLKO.1 570 CDS 100% 4.950 2.475 Y Vmn1r14 n/a
7 TRCN0000125502 CTGACCTTTGTTCACATAATA pLKO.1 133 CDS 100% 15.000 7.500 Y Vmn1r16 n/a
8 TRCN0000250949 TGACCTTTGTTCACATAATAA pLKO_005 134 CDS 100% 15.000 7.500 Y Vmn1r9 n/a
9 TRCN0000198622 CACTAAATCCTGCTCACTCTT pLKO.1 477 CDS 100% 4.950 2.475 Y Vmn1r19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.