Transcript: Mouse XM_017321351.1

PREDICTED: Mus musculus predicted gene 973 (Gm973), transcript variant X15, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm973 (381260)
Length:
4618
CDS:
1779..4424

Additional Resources:

NCBI RefSeq record:
XM_017321351.1
NBCI Gene record:
Gm973 (381260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267666 ATTCAACAGAGATCGTCTTAT pLKO_005 1722 5UTR 100% 13.200 9.240 N Gm973 n/a
2 TRCN0000267727 TGCTATAGATGGAAGATTATC pLKO_005 3596 CDS 100% 13.200 9.240 N Gm973 n/a
3 TRCN0000267667 GAATGGGAAATTGATACATAC pLKO_005 1758 5UTR 100% 10.800 6.480 N Gm973 n/a
4 TRCN0000201143 CCAAAGGTCCTGAGTTCAAAT pLKO.1 337 5UTR 100% 13.200 6.600 Y Ptcra n/a
5 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 345 5UTR 100% 2.640 1.320 Y Adsl n/a
6 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 345 5UTR 100% 2.640 1.320 Y Adsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.