Transcript: Mouse XM_017321408.1

PREDICTED: Mus musculus inositol 1,4,5-trisphosphate receptor 1 (Itpr1), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Itpr1 (16438)
Length:
9885
CDS:
364..8610

Additional Resources:

NCBI RefSeq record:
XM_017321408.1
NBCI Gene record:
Itpr1 (16438)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321408.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285048 GGTCGAAACGTCCAGTATATC pLKO_005 4270 CDS 100% 13.200 18.480 N Itpr1 n/a
2 TRCN0000012441 CGAGGTTAAGATCGCTTACAT pLKO.1 4611 CDS 100% 5.625 7.875 N Itpr1 n/a
3 TRCN0000273759 CGAGGTTAAGATCGCTTACAT pLKO_005 4611 CDS 100% 5.625 7.875 N Itpr1 n/a
4 TRCN0000321161 GGAATCGAAACTTCGAATATA pLKO_005 7020 CDS 100% 15.000 12.000 N Itpr1 n/a
5 TRCN0000012440 CGAGAGTTTGATGAAAGCAAT pLKO.1 3358 CDS 100% 4.950 3.960 N Itpr1 n/a
6 TRCN0000273767 CGAGAGTTTGATGAAAGCAAT pLKO_005 3358 CDS 100% 4.950 3.960 N Itpr1 n/a
7 TRCN0000012442 GCCTCTTTAAGCTATGTCCTA pLKO.1 530 CDS 100% 2.640 2.112 N Itpr1 n/a
8 TRCN0000012438 GCAGTAGGTAAGAAGTTATTA pLKO.1 9522 3UTR 100% 15.000 10.500 N Itpr1 n/a
9 TRCN0000273710 GCAGTAGGTAAGAAGTTATTA pLKO_005 9522 3UTR 100% 15.000 10.500 N Itpr1 n/a
10 TRCN0000012439 CGGCATAACAAAGAACTTCAA pLKO.1 6850 CDS 100% 4.950 3.465 N Itpr1 n/a
11 TRCN0000061245 GCTCGGCATAACAAAGAACTT pLKO.1 6847 CDS 100% 4.950 3.465 N ITPR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321408.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.