Transcript: Mouse XM_017321411.1

PREDICTED: Mus musculus inositol 1,4,5-triphosphate receptor 2 (Itpr2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Itpr2 (16439)
Length:
10970
CDS:
45..7598

Additional Resources:

NCBI RefSeq record:
XM_017321411.1
NBCI Gene record:
Itpr2 (16439)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277566 AGCTGAAGGTTATCGAGATTT pLKO_005 2401 CDS 100% 13.200 18.480 N Itpr2 n/a
2 TRCN0000277496 GCCCGGAACCTCATCTATTTC pLKO_005 2094 CDS 100% 13.200 18.480 N Itpr2 n/a
3 TRCN0000277567 ATTGCGATCCCAGTCGATTTG pLKO_005 4137 CDS 100% 10.800 15.120 N Itpr2 n/a
4 TRCN0000097135 CCCACAAAGATCACGATTCAT pLKO.1 1914 CDS 100% 5.625 7.875 N Itpr2 n/a
5 TRCN0000277497 TGTCATGCTCAGATCGATATA pLKO_005 6371 CDS 100% 13.200 10.560 N Itpr2 n/a
6 TRCN0000097138 GCCTTTAAACAGGTGCAGTTA pLKO.1 2769 CDS 100% 4.950 3.960 N Itpr2 n/a
7 TRCN0000097137 GCCGAGGTTTCTGGACTATTT pLKO.1 1373 CDS 100% 13.200 9.240 N Itpr2 n/a
8 TRCN0000285980 GTGACCAGCCTTTCATCGGAT pLKO_005 7616 3UTR 100% 2.640 1.848 N Itpr2 n/a
9 TRCN0000097134 CCTGCCTCATCACAGAGGGAT pLKO.1 7638 3UTR 100% 0.880 0.616 N Itpr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.