Transcript: Mouse XM_017321623.1

PREDICTED: Mus musculus transmembrane protein 72 (Tmem72), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem72 (319776)
Length:
4769
CDS:
559..1257

Additional Resources:

NCBI RefSeq record:
XM_017321623.1
NBCI Gene record:
Tmem72 (319776)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321623.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257828 CTACGGCTGCAGTGTTGATTG pLKO_005 463 5UTR 100% 10.800 15.120 N Tmem72 n/a
2 TRCN0000177080 GCAAACCTATACTTTCCATGA pLKO.1 927 CDS 100% 4.050 5.670 N Tmem72 n/a
3 TRCN0000248918 CATTCCAGGCTCCATGTTAAT pLKO_005 771 CDS 100% 13.200 9.240 N Tmem72 n/a
4 TRCN0000257820 GACCTCCAGCAAGGTACAAAT pLKO_005 1420 3UTR 100% 13.200 9.240 N Tmem72 n/a
5 TRCN0000181873 GCAGACCCAAGATACCCTAAT pLKO.1 1026 CDS 100% 10.800 7.560 N Tmem72 n/a
6 TRCN0000248919 GCAGACCCAAGATACCCTAAT pLKO_005 1026 CDS 100% 10.800 7.560 N Tmem72 n/a
7 TRCN0000248917 TGTGTGAAGGGACCTACTTTG pLKO_005 590 CDS 100% 10.800 7.560 N Tmem72 n/a
8 TRCN0000178181 GATAGTGACAGTGAACCAGAA pLKO.1 1150 CDS 100% 4.050 2.430 N Tmem72 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321623.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.